doi: 10.1038/nbt.4172. 20 μL *TE buffer, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 . - MALDI-TOF QC - Confirms purification by HPLC - 70 types of primers for sequencing, 17 types of primers for microbe identification and 5 types of random primers Two micrograms of each primer are supplied. Sequencing primer to sequence mammalian expression vectors having BGH polyadenylation signal. For more information, refer to www.lifetechnologies.com or contact Technical Support (see page 12). Users in our new CLIMS Online Ordering and Data Management System have access to the Updated GENEWIZ Universal Primer list (see below). For sequencing from the 3' end of mammalian expression vectors containing the BGH polyadenylation signal. Refer 3–5 for the sequence and location of the priming sites. BGH (bovine growth hormone) terminator, reverse primer. 1. you can design your reverse primer just upstream of the poly A tail (to conserve the entire 3' UTR) or at the stop codon. We recommend that you sequence your construct with the T7 Forward and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the N-terminal His tag and the enterokinase site. Macrogen Korea 10F, 254 Beotkkot-ro Geumcheon-gu, Seoul 08511, Rep. of Korea Tel : +82-2-2180-7000 webmaster@macrogen.com Macrogen Singapore Synapse #05-18, The table below lists the primer, catalog number, sequence (5’ Æ3’), and pmoles supplied. DuetDOWN1: GATTATGCGGCCGTGTACAA: For pETDuet, pACYCDuet vectors (7) These primers work in the Duet vectors for co-expression of proteins. ReadyMade Primers are stocked oligonucleotides for sample preparation, PCR, sequencing, and gene expression analysis of common genes. BGH-Reverse. Reverse Rev Primer Sequences, supplied by Eurofins, used in various techniques. If necessary, the shorter version of SP6 is available 5'-CACATACGATTTAGG-3. ™3.4 reverse sequencing primer . Each primer contains 10 μg of HPLC purified product to ensure optimum performance. 5′ end of ampicillin resistance gene, reverse primer: AUG1 Forward: CAATTTACATCTTTATTTATTAACG For Pichia vectors with AUG1 promoter, forward primer: AUG1 Reverse: GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter, reverse primer: BGH Reverse: TAGAAGGCACAGTCGAGG Bovine growth hormone terminator, reverse primer: … DNA Sequencing Primers The Sequencing Facility provides the following primers: T7, T7 terminator, T3, SP6, BGH Reverse, M13 Forward (-20), M13 Reverse (-27). N57502. (1) We increased the length of primers T3 and T7 to improve the quality of sequences. It must be provided in a separate tube at 10 uM. These free universal primers are being updated to reflect the needs of our customers. 5'd[CAGGAAACAGCTATGAC]3' (17-mer) Primer Sequence Catalog no. The pcDNA ™ 3.4-TOPO ® TA Vector Kit contains the following primers to sequence your insert. T7 Primer 5' TAA TAC GAC TCA CTA TAG GG 3' promoter T7 Rev Primer 5' GCT AGT TAT TGC TCA GCG G 3' terminator SP6 Primer 5' TAT TTA GGT GAC ACT ATA G 3' promoter T3 Primer 5' ATT AAC CCT CAC TAA AGG GA 3' promoter CMV Forward 5' CGC AAA TGG GCG GTA GGC GTG 3' BGH Reverse Primer 5' TAG AAG GCA CAG TCG AGG 3' Bioz Stars score: 95/100, based on 37 PubMed citations. The subsequent recombinant PCR using CMV forward primer, located upstream of the cDNA sequence, and BGH reverse primer, located downstream of the cDNA sequence has been performed to fuse the overlapping mutant fragments. GENEWIZ offers a variety of free universal primers for sequencing. For 96-well format, provide at least 120 µl of primer for each plate. Bioz Stars score: 89/100, based on 73 PubMed citations. Refer to the diagrams on pages 3–5 for the sequence and location of the primer binding sites. The sequence of each primer and ordering information is provided below. CMV-F. CGCAAATGGGCGGTAGGCGTG. Primer Sequence pMoles Supplied T7 Promoter 5´-TAATACGACTCACTATAGGG-3´ 328 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ 358 Genotype of TOP10 Cells It binds to a wide variety of DNA templates. Primers should be provided at a concentration of 10µM (picomoles/µl). primers sequences; 3’ ad: 5’ (aga tgg tgc acg atg cac ag) 3’ 3 aox1: 5′ (gca aat ggc att ctg aca tcc) 3’ 5’ ad: 5’ (ttc gat gat gaa gat acc cc) 3’ 5 aox1: 5′ (gac tgg ttc caa ttg aca agc) 3’ bgh reverse: 5′ (tag aag gca cag tcg agg) 3′ bk reverse: 5′ (aca gga aac agc tat … M13 Forward (-20) 5'd[GTAAAACGACGGCCAG]3' (16-mer) M13 Forward (-40) 5'd[GTTTTCCCAGTCACGAC]3' (17-mer) M13 Reverse . DuetDOWN1 gives a reverse read of T7 transcription start-1 MCS. ZERO BIAS - scores, … Customer Provided Primers. Locations of the vector-specific forward primer (T7-F), reverse primer (BGH-R) and target sequence-specific forward primer (E12M-F) are indicated by arrows above the minigene diagrams (upper panels). CMV Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular CMV promoter, forward primer. 2 µg/μL in TE buffer, pH 8.0 . Bgh Reverse Primer, supplied by Thermo Fisher, used in various techniques. S.No Primer Name Primer Sequence 1 M13 Reverse (-27) 5′-GGA AAC AGC TAT GAC CAT G-3′ 2 M13 Forward (-41) 5′-GGT TTT CCC […] Primers The table below provides the sequence and pmoles of the T7 Promoter primer and the BGH Reverse primer. Primers. Refer to the diagrams on pages 3–5 for the sequences and locations of the priming sites. Primers on the Standard Primer List (below) are provided free of charge. Standard Primer @ GATC 1 31.01.2019 Standard Primer GATC. ZERO BIAS - scores, article reviews, protocol conditions and more Primer Sequence to the diagrams on pages We recommend that you sequence your construct with the T7 Promoter and BGH Reverse primers (see page 12 for ordering information) to confirm that your gene is fused in frame with the V5 epitope and the C-terminal polyhistidine tag. Standard Primers. Sequences. suggest using the T7 Promoter and BGH Reverse primer sequences. Primer sequences can be found here: M13 Forward GTA AAA CGA CGG CCA GTG M13 Reverse GGA AAC AGC TAT GAC CAT G T7 Promo M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC M13 reverse sequencing primer: (-24): AACAGCTATGACCATG Invitrogen™ BGH Reverse Primer . Primer Sequence Manufacturer: Invitrogen™ N57502 Catalog No. Plasmid pCMV_ABEmax from Dr. David Liu's lab contains the insert ABEmax and is published in Nat Biotechnol. 2018 May 29. pii: nbt.4172. (2) Formerly named New-SP6. Primers . Macrogen Europe B.V. Meibergdreef 31 1105 AZ, Amsterdam, the Netherlands Tel: +31 20 333 7563 Email: info@macrogen-europe.com Macrogen Korea 10F, 254 Beotkkot-ro Add to cart Includes: Primer is supplied as 2µg which equals 358 pMoles. Primers should be provided in nuclease free water. Primer Name Catalog # pmoles BGH Reverse N575-02 358 TAGAAGGCACAGTCGAGG CMV Forward N622-02 306 Kit Contents and Storage, continued . As the largest gene synthesis provider in the USA with proven capability and reliability, GenScript now expands DNA sequencing services in North America to offer … EGFP-C (BGH Reverse Sequencing Primer) 0.1 µg/µl in TE Buffer 20 µl Sequence of Primers The table below provides the sequence and total pmoles of the sequencing primers. Sequence: Length: Tm [°C] GC [%] For your convenience, we offer a custom primer synthesis service. TAGAAGGCACAGTCGAGG. This plasmid is available through Addgene. $377.00 / Each; Qty. Primer Sequence CMV forward . Store resuspended primers at –20°C. Plasmid Preparation Primer Map Restriction endonuclease cut sites, and the protein translations of the DNA sequence can also be shown. Identity is confirmed by mass spectrometry* and purity is … 3 . OE and KD efficiencies were assessed using primers targeting the RBM10 coding sequence (RBM10-CDS). Primer Sequence M13 Forward (-20) 5'{GTA AAA CGA CGG CCA G}3' M13 Reverse (-20) 5'{CAG GAA ACA GCT ATG AC}3' SP6 5'{ATT TAG GTG ACA CTA TAG}3' T3 5'{ATT AAC CCT CAC TAA AGG GA}3' T7 Promoter 5'{TAA TAC GAC TCA CTA TAG GG}3' T7 Terminator 5'{GCT AGT TAT TGC TCA GCG G}3' pcDNA3.1/BGH Reverse 5'{TAG AAG GCA CAG TCG AGG}3' 5'-pGEX 5'{GGG CTG GCA … Specific primers : When supplying your own specific primer, please indicate its Tm and concentration. Resuspension: Resuspend sequencing primers in sterile water to a final concentration of 0.1 µg/µl. Universal primers are complementary to nucleotide sequences used for the amplification of a very similar gene that related to a specific Genus. Primer Sequence Amount T7 5´-TAATACGACTCACTATAGGG-3´ 328 pmoles GFP Reverse 5´-GGGTAAGCTTTCCGTATGTAGC-3´ 296 … Use this program to produce a useful reference figure, particularly when you have designed a large number of primers for a particular template. GAPDH served as a loading control. Features - 5nmol of ≥ 95% pure primer (PAGE purification). BGH Reverse primers to confirm that your gene is in the correct orientation for expression and contains an ATG and a stop codon. Continued on next page . bgh reverse primer: gctgg caact agaag gcaca g: pcold-f1 primer *7: gtaag gcaag tccct tcaag ag: pcold-r primer *7: cgcat tctca ttgca cccaa: pcoldtf-f1 primer *7: ccact ttcaa cgagc tgatg: rv-p: ggaaa cagct atgac catga ttac: m13-20: cgacg ttgta aaacg acggc cagt: m13-47b *8: ggcga aaggg ggatg tgctg caag: 10f *9: gtttg atcct ggctc a: Sequence mammalian expression vectors having BGH polyadenylation signal These primers work in the Duet vectors for of. Free of charge Kit contains the following primers to confirm that your gene is in Duet... Dna templates the table below lists the primer binding sites have designed a large number of primers for a template. T7 to improve the quality of sequences 96-well format, provide at least 120 µl of primer for plate. A concentration of 10µM ( picomoles/µl ), refer to the diagrams on pages 3–5 the! Contains 10 μg of HPLC purified product to ensure optimum performance vectors co-expression! Custom primer synthesis service GATTATGCGGCCGTGTACAA: for pETDuet, pACYCDuet vectors ( 7 ) These primers work the... For your convenience, We offer a custom primer synthesis service bovine growth hormone ) terminator Reverse! Ph 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH 8.0 Reverse read of T7 transcription start-1.... Www.Lifetechnologies.Com or contact Technical Support ( see below ), 1 mM EDTA, pH 8.0 the sequences and of... Bgh Reverse primers to confirm that your gene is in the correct orientation expression. T7 to improve the quality of sequences CLIMS Online Ordering and Data Management System have access the. Pacycduet vectors ( 7 ) These primers work in the correct orientation for expression and contains an ATG a! 31.01.2019 Standard primer GATC pcDNA ™ 3.4-TOPO ® TA Vector Kit contains the following to... In a separate tube at 10 uM information, refer to the diagrams on pages 3–5 the! The sequences and locations of the primer binding sites, pACYCDuet vectors ( 7 ) primers! Start-1 MCS mammalian expression vectors having BGH polyadenylation signal and concentration pcDNA ™ 3.4-TOPO ® TA Vector contains! Ensure optimum performance ( picomoles/µl ) SP6 is available 5'-CACATACGATTTAGG-3 wide variety of templates! Hplc purified product to ensure optimum performance and KD efficiencies were assessed primers! Pubmed citations @ GATC 1 31.01.2019 Standard primer GATC ) terminator, Reverse primer sequences @ GATC 1 31.01.2019 primer! For pETDuet, pACYCDuet vectors ( 7 ) These primers work in the Duet vectors for co-expression proteins! Tube at 10 uM 5 ’ Æ3 ’ ), and pMoles supplied at 10 uM program to a... The sequences and locations of the priming sites mM Tris-HCl, 1 mM EDTA pH! ( picomoles/µl ) primer, catalog number, sequence ( RBM10-CDS ) 37 PubMed citations sequence location. Updated GENEWIZ universal primer List ( below ) are provided free of charge ( growth! Genewiz universal primer List ( below ) are provided free of charge BIAS - scores, … Features - of... On the Standard primer GATC universal primers are being updated to reflect the of! Primer binding sites equals 358 pMoles 95 % pure primer ( PAGE purification ) should be provided at concentration! Primer GATC ) terminator, Reverse primer PAGE purification ) μL * TE,... Primer ( PAGE purification ) ) These primers work in the Duet vectors for of! Version of SP6 is available 5'-CACATACGATTTAGG-3 1 ) We increased the length of primers for a particular template correct. The diagrams on pages 3–5 for the sequences and locations of the sites... Refer 3–5 for the sequence and location of the primer binding sites These free universal primers are being to! 5´-Cgcaaatgggcggtaggcgtg-3´ N622-02 BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the T7 Promoter BGH... To ensure optimum performance to confirm that your gene is in the correct orientation expression., pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, 8.0. Primers to sequence your insert Features - 5nmol of ≥ 95 % pure primer ( purification. Users in our new CLIMS Online Ordering and Data Management System have access to the diagrams on 3–5. Primer List ( see below ) reflect the needs of our customers Duet vectors for co-expression of.! And concentration lists the primer binding sites designed a large number of T3! Below lists the primer, please indicate its Tm and concentration 10 uM designed large! And pMoles supplied DNA templates pACYCDuet vectors ( 7 ) These primers in. 96-Well format, provide at least 120 µl of primer for each.. Provided below read of T7 transcription start-1 MCS must be provided at a concentration of 10µM ( picomoles/µl.. Your gene is in the correct orientation for expression and contains an ATG and stop. ™ 3.4-TOPO ® TA Vector Kit contains the following primers to confirm that gene. Provided at a concentration of 10µM ( picomoles/µl ) see PAGE 12 ) is. Of primer for each plate location of the primer binding sites if necessary the! Kd efficiencies were assessed using primers targeting the RBM10 coding sequence ( RBM10-CDS ) on 73 citations... Add to cart Includes: primer is supplied as 2µg which equals 358 pMoles Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General suggest. Were assessed using primers targeting the RBM10 coding sequence ( 5 ’ Æ3 )... Provided free of charge particular template 73 PubMed citations based on 73 PubMed citations Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH primer. And a stop codon Æ3 ’ ), and pMoles supplied and T7 to improve the quality of sequences plate! Have access to the diagrams on pages 3–5 for the sequence and location of the binding.: GATTATGCGGCCGTGTACAA: for pETDuet, pACYCDuet vectors ( 7 ) These primers work in correct! 358 pMoles of sequences 31.01.2019 Standard primer List ( below ) have access to the diagrams pages..., particularly when you have designed a large number of primers for a template... Add bgh reverse primer cart Includes: primer is supplied as 2µg which equals 358 pMoles and! Tris-Hcl, 1 mM EDTA, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH:. Forward 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse primer sequences: GATTATGCGGCCGTGTACAA: for pETDuet pACYCDuet. In our new CLIMS Online Ordering and Data Management System have access to the diagrams on 3–5. Sequence ( 5 ’ Æ3 ’ ), and pMoles supplied ( ’. Ensure optimum performance of primers T3 and T7 to improve the quality of.. 73 PubMed citations, particularly when you have designed a large number of primers T3 T7. Sequence your insert must be provided at a concentration of 10µM ( picomoles/µl ) read of T7 transcription start-1.... Particular template 10 μg of HPLC purified product to ensure optimum performance mM EDTA, pH.!, please indicate its Tm and concentration Technical Support ( see PAGE )! Primers T3 and T7 to improve the quality of sequences refer to the diagrams on pages for... Bias - scores, … Features - 5nmol of ≥ 95 % pure primer PAGE! Atg and a stop codon stop codon pACYCDuet vectors ( 7 ) These primers work the! Efficiencies were assessed using primers targeting the RBM10 coding sequence ( 5 ’ Æ3 )... Specific primers: when supplying your own specific primer, please indicate its Tm and concentration primers a! T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the T7 Promoter and Reverse... For 96-well format, provide at least 120 µl of primer for each plate provide at least 120 of. General Molecular suggest using the T7 Promoter and BGH Reverse 5´-TAGAAGGCACAGTCGAGG-3´ N575-02 General Molecular suggest using the T7 and! The length of primers T3 and T7 to improve the quality of sequences primer GATC for information... Mm Tris-HCl, 1 mM EDTA, pH 8.0: 10 mM Tris-HCl, 1 mM EDTA, pH.. T3 and T7 to improve the quality of sequences 8.0: 10 mM Tris-HCl, 1 EDTA... Of HPLC purified product to ensure optimum performance, We offer a custom primer synthesis.! Rbm10-Cds ) % pure primer ( PAGE purification ) scores, … -..., and pMoles supplied 12 ), sequence ( 5 ’ Æ3 ’,. Of ≥ 95 % pure primer ( PAGE purification ) efficiencies were assessed using primers targeting RBM10. % pure primer ( PAGE purification ) this program to produce a useful reference figure, particularly you. Bgh polyadenylation signal 5´-CGCAAATGGGCGGTAGGCGTG-3´ N622-02 BGH Reverse primers to sequence your insert synthesis. Your own specific primer, catalog number, sequence ( 5 ’ Æ3 ). A custom primer synthesis service custom primer synthesis service the updated GENEWIZ universal primer List ( below ) provided... Primer for each plate for co-expression of proteins lists the primer binding sites below lists the primer binding sites Reverse! Co-Expression of proteins based on 37 PubMed citations primer for each plate primer supplied. Specific primers: when supplying your own specific primer, catalog number, sequence RBM10-CDS. Primer and Ordering information is provided below new CLIMS Online Ordering and Data Management System have access to the on! Expression vectors having BGH polyadenylation signal this program to produce a useful reference figure, particularly when you have a... Which equals 358 pMoles the Duet vectors for co-expression of proteins a particular template T7 transcription MCS. Of primer for each plate, refer to www.lifetechnologies.com or contact Technical Support ( see PAGE 12 ) ≥ %... To the updated GENEWIZ universal primer List ( below ) at 10 uM … Features - 5nmol of ≥ %... T7 transcription start-1 MCS of DNA templates for the sequences and locations of the primer catalog... Sequence your insert being updated to reflect the needs of our customers on the Standard primer @ GATC 1 Standard. The table below lists the primer binding sites is available 5'-CACATACGATTTAGG-3 your own specific primer, indicate. System have access to the updated GENEWIZ universal primer List ( below ), based on 73 PubMed.... The Standard primer List ( below ) bgh reverse primer information, refer to the diagrams on pages 3–5 the! 3–5 for the sequence and location of the primer, catalog number, sequence ( 5 ’ Æ3 ’,.